The following data will be submitted to http://genome.ucsc.edu/cgi-bin/hgBlat

  

type: DNA
output: hyperlink
Other options
Genome: 
userSeq
>scaffold__196:161951..165594
TATGGTGGTAACAAAATAAAAAAAACTACAAAAATAATCTGAATCACTAATATATATTTT
TTTAATTTCTAAATATGCAAAAATTAAAGAATTGTCATTGTTACACATTCAAAGAGTTCC
AAAGCTGCAACTAGTATAGAACCAATGTTTGAATGAAAGATTTGGAAGACACTTCATATT
CAACTCATCTGTATTTATATAGCATCTGTTATAAAAGCTATGTGGATTATGAAAAGGAAA
TTGTCAAAATAAATGCATATTGAAAAAATCTTTCTTATAACCAGCATTTCTTTTTCAGTA
TTTTTCTTTTTCCTCCACAATTTCGTATTCATGGTCGCTATCAGAGGATTCTTCGGGGAC
TTGTGGTGGCACTGGGGAGAGATGATATTCTTCCAGTTACTACTACATTTTTTTGCCCAC
TTTTTAAAAGTGGTACATACCGGTATCATCAGTGGTACTCTCATGGTCAAAACTTGCCAG
AAACAGGTCTTACCATTTTTCTTCATGTCATTCATTCTTAAAAGCATGTCTGCCTGAGCC
TGGCAGATTGTCATTTCCACTGCAGGCTGCTTTCGAAGCGTTACAGGTTGAGCCTGTTCA
TCAGAGATAATCTGCATGATTATAAAAGAGGAACCAGTAGGTCTATAACCAGTAAGTATA
TATATAGATATATATATCTATATAGATATATACACACACACACACACATATGCAGTATAT
TTTATATACAGGTATATGAGAGTCAGTATATCCTGCAAAATAATCATTTCTCATATATAT
ATATATATATATATTATATACAAACTACTGTATATATTATATACAAACTACTGAATAAAA
TCCATACTCACTTCAGGTAGCATAGCTTGGGGCCTTTTTTTGACATTTAAAGTCAAATTG
GCTAACGATTCTGTTGGACTGCCCCTTTGCGATTGATGTTCGCGCGGTTTCTGTTTGCAT
GTATCATTGTAAGACTTTGGTGGTCGAGGTGGAGGTGGAGCATCTGTGTTGTCCCTTTTG
CAAAATTCATAAAAGAATGTATTTGTCACTTCTGTCACACTTTCCACATGACACGTAGGT
GGTTGATTGTCATGCCATGGAAGGGGTTCTGTGGTGAAAGACACATGCATCGAAATCCAC
TGAGCTGGGATCTCAAAGCAGTACTCTGGACTGTGCGGGAAGCTTGCCAGGATGGTTGGT
TCGAACAGAGTACTCTCGATTCTGAGGCATGGGAGCCCAGCCAGAGGGTCATTCTGCAGT
TTAGGATCAAGGCTTACCACTTTAATGTCCAGGGGTAAACTAAACTTCTTTCCCAAATCT
TTAAGGCTGTACTTTCTGTTTTCAGTCAGCACCTCCACAAAGTGATTCTGCATATACAGG
GGAAGAATAACTTCTTGTTTCCCATCCTCCAAGCATTCCTCGTCATCATTATCATCATCC
AGGTAACCTGGTTCCGGGAGACGCTGACACAGCAAAGCCTCAACAGATTCAGACTTCCCA
GCGTGGCCTGGATGAGGCAACTTCATCCATTTACAGCAGACAACCTCCAGCTGTTCACCC
ACACTGAGGACAGGCAGACCTTCTCCCTCCACCTCCTTGCTGTTTTTTGTCACACTGACT
CTCAGACCAGGTGCCTGCAGTGATGCAACATAGAGCTCGTACACTGAATTAAATTCTCTT
GGCTGCCTCCGAAATCGTCCGCCATATATGTCAGAAACCAAGAAGTACTTCTGTGTTTTT
CGATTTTTCATACTGGATAATATAACCATACCCGTGGTTCCTGCTTTGTGGAAAACCAGG
TGTTGGTGCAGGCTAAGTTGTGGCATCCAGTTGCACTTCAGCAGAGAAAAACTTTTAGGC
GGTTCCAGTATGTTTACTACCACAGGGAAAGATTCTTTTGGTTCAGACAAGACCTCTGTC
AGACTGAGTGGCTTTTCGAAAGTCACATCCTTACAATCCTCTGTGACATCGACCACATCA
ACCTCAAGGCTGGAGGGAAACTTCAGGATTTCCTTTCTTACTGTAAGAAATCAATTAAAA
AAACATTAGTGAAGTAACTCAGTATAAAATGCTAATTGTATATGAAAAAAGAACACAAAA
CATAATTCTTGAAATTGAATACCATTTAGTTTAAGTGGTAACTTTACCATTGCAATTTCC
CCGCTAAATCTGATCTTTTCAAAAAGTAATTTGTAAGCCTCAAATTCCTCAAGGACCTCT
AGGGTGTTTCTTGAGTTCAGGTTAAATCATATAATAATGTACCCTGAACACCCTGAATAA
TACAGCCTCACTTCATGGGATGTACTTTAATTTTTGTGATCATAAAAATAGTTAGGTGCT
GATTTGTTTGTTATGGGGAAACCATTTATTCCAAAAAAAGAGAAGCTGTCAAGTGCATTG
CTGGGTAAATTTGCTTACCAAGGCACTGTGGTATTTATGGGTGTGGAAGCTATTTCTAGG
TAGTCATGGAGTTTCCAAAGATTAGAACTGTGTACCGGTTCTTGGAAAATGACATAAACT
AGTTTTATAAAATACAGATCCACTATGATGTTTTCTCCCCTTCCTTTTCTCTACATGAAT
TCACAGCAGCAGTATGTTCCTCTTACAGTTCATGAGAGCGTGGACCTGGTACACTGGTGT
GAGAACTAGTGGTCGATCGCACTTCTTGCCAATGAAGCGAAACCTTCGACTATTCAGCAA
TGGTGATGATAAAATCTGCTGGAGGGTGAAGCACTCCTCCTGCTCACACTCCGCAAATTG
CCCACGGACAGAAAGAGGGATGGCAACTTCAGCTGCCTCATGGTGACCCTGGACCTTACA
GCGCAGTTTATCTTCTTTGCCCTCTTTCCGCTCAATAGAGAGCACTGTCAAAACTGTTCC
AGCCCCCACTGTGAGATTTTCGAATGCTATCTTGGAGCAGCTGGTGAAGGTGAAGGAGGA
GCTGGATTCCAGCGTGACAGGCATAAGAGTCACCATCTCTTCTACTGAACTGTATGGTAT
CATCTCTGGAACCATCTTAAACAAGCCTAAGAAAACAGCAGTGGTCAGTTTGGGAAAAAC
AATTGATTTGCAGTTTTGGGGAGAATCTTCAAACGGACCTGTGTAGTTAATAGGGAGCTC
AAATTTCTCATTCATGCTGATGTCCTCGCAGCAAACGGACACAAGCTCAGTGTCAATTAC
TTTTATTAAATCTCCAGTAGAAAAGGACACTTCATAACCAGAAACGTCATATACAGACCC
TGTTAAAAAAGAAATGGAGTATAAAAAGAGCAAGCAGACACTTTCAACTTGCAGCAATAA
GTCTATTCATCTGTTCTTATGTAACTCCACAATCTTACATAGTGTATGGTTTTAATTTAC
ATTATGTATATTATTTTATATACATTATGATCAATTTTTCTACAACTTTTACTCTAACTC
TATATGTTAGTGTGCGACATTGACCTTTAAATTGTGGTGTAGAAGCAAAGAAATGCACAT
ACAAAATAGAAACAATCTAAAGTGAGATTTCTTACAATTCACCCACAAGTAAAATCATAG
AATTGATTACCTTGGAAATAAACTCCAGAATAAACTTGAAGAATTCTTGGCAAACATTTT
TTGTCCAAGGAGGCAATGAGATCCTGCAGCGGCAAAACGACCGA