The following data will be submitted to http://genome.ucsc.edu/cgi-bin/hgBlat

  

type: DNA
output: hyperlink
Other options
Genome: 
userSeq
>group_XX:17779843..17782571
TTAGCCGTTGGGGGTTTCCGGGGGCCAACTGGCGGAGGCTGATCGTCCAAGATACCCTGC
ACAATAAAGGGAAGTAAAAAACGTTCATCTTTATTACGAGGGTGACTCGATGACCGCAGC
AAAAAGTGGAAGCGCCGTTAATTTGCATAGGAACCTGTTTTTCTTTTTTTTTACCAGAGA
GAGATTTCCTGAAAGTCACATTGTGAGAAAACATGTTTCTCAGAGACAGAAGTTGAAGCG
TGTCGTAATGAGATAGATGAGACACGTGACCTATTCAAAATGGCATTTTAAACGCAAACG
ATGTTAAACATCTCGCTCGCTGTCATGCATGCAGGGAAAAGGTGTACTCACTGGAGTTGG
TGGAGCCGGAGGCCTTCTCTTATTCAAAGTCAAAGCCGCCATCTCTTTGGTCGGGACGCT
CTTGTCCGGTTCCCTGGACTTTCTTGCCTTGGAAGTTTTCTTTGAGGATTCATTTGAAGA
CGTTGCGGACGACAGATTGCGCTTCGGCGGTCGAGGCGGTGGAGGCGCGTCCGAGTTCCC
CTGTTTGCGGAACTCGTAAAGGAAAGTGTCCGTCACCTCGGTGACGAGATCCGCGTGGCA
CTCGGGCGTTTGACCGGCGGGCCACGGCAGGGCTTCCCTGGTGAAAGAGACGGACATCGA
GAGCCACTGGGTCAGCATCTCGAAGCGGTGGTCCGGCCGGTGCGGGAAGCTCGCCTGGAT
GCTGGGCTCCAACATGGCGGCCTCTATTCTGAGACACGGGAACCCGACCAGGGGATCGGC
CTCCAGCTTTGCGTCCCGGCTCACGACCTTCACGTCCAGCGGCCAACTGAACTGCTCACC
CAATTCTTTGAGTCTGTACTTCTTGTTGTCGGCTATCACCTCCACGAAGTGACCCTGCAT
GTACAGAGGCAGGAAGATCTCCTCGCTCCCATCCTCCCGCTCGACCTCCTCTTCGTCCTC
ATCGTCGCAGTCGTCGTCCGCCTCTTGGAGACGCAGACACAAAAGAGCCTCCACGGCCGG
CTTCTGTCCCCGGGCACCGTCGCGCGCCAGCTCCACCGTATCGCAGCGGACGACCTCCAG
CTGGTCGCCCACACTGAGGGCAGGCAGGCCTTCCTCCTCGTCTTCCTCGCAGCTCCGCGT
CACGGCCACCTTCAGGCCCGGGGCCTGCATCGAGGCGACGTACAGCTCGTACGCCGAGTC
GAACTCTCGCGGCCGCCTCCGGAATCGGCCACCGTATTGCTGAGATACCAGGAAGTGCTG
CTGTGTCTTTCTGCCCCTCAAGCTGGACAATAAAACCACGGCGGAGGTTCCGATCTTGTG
GAAAATCACGCGGGCGTCTTTGGTGAGTTCTGGCAGCCAGCTGCACCTGAACGGGGAGTG
GGTGTCCGGGCCCTCCAGTATCTCCACCACCGTCGGGAAGGACTCTTCCGGCTGGGAGAG
GACCTCCGTCAGACTGAGCGGGGTCACGAAATCCACATCGCCGCACGTCTCTGTGACGTC
GACCACGTCCACCTCCAAGCTGGAGGGAAACTTAAAGATGTTTTTTCTCACTGCAAAAGA
AGAAATTAGAGGAAATACGTTTAAAATGCATTAGAGGAAGTTGATGAAGTCCACTGCGCC
TCTTCGGGGACGGAAGATAAAACATGTCAAAATGCTGTGTGTGCCAGATAACTGTGATTA
TTTTCAAAGGATAAACGGCAAAAGGTTATCCTCACAGTTCATGACGGCGGCGACCTGGTA
TATCGGGCTGAGGACGAGGGGCCGCTGGCTCTTGGTGGTGTTGACGAAGCGAAACCGTCG
ACTGCACAGGCAGGGCGAGGACAGGATCTCCTGCACGGTGAAGCACTCTTCGCTTTCGCA
CTCCCTGAACTCCCCATGGAGAGAAAGCGGGAGACACACTTCGGCGGAGACTTCCTGTTG
TCCCCGAACGTGGCACCGCACGAGGTCCTCCTCGCCCGCGTGCCGCTCGACCGAGAGCAC
CGTCAGAGCCGTGTTGGCCCCCAGCGTGTAGCTGCCGACGTCGATCCTGGAGCGGCTGGT
GAAGGTGAAGGGGAGGCAGGAGTCCAGGCCCACGGGCCTCAGGCTCAGCATCTCCTCCAG
CGTACTGTAGGGCATCTCCTCCGGGACCACCTTGAACAGACCTGAGCAGAGGCGCCTGGG
TGTCAGTGCGCCGCCACCAAGCCAAGCAACAACATTTCTCGCCGGAGTCTCGTACCTGTG
TGGTTGATGGGCAGTTCAAACACCTCATTGTTGCCGACGTCTTCGCAGGAAACCGACAGG
AGCTCAATGTCGATGACCTTTATTAGGTCCCCGGTAGAAAAGCTCACTTCACTCCCAGAG
ATTTCATATACAGACCCTGAAACGGAGATTGAGAATTTAACCAAAGAAGGGACTGAATGG
CAAGATCAGTAACGAGCAGATAGATCAGGTACGAATAACCCGCTTTGCTGACGCAGTTCT
AGGCTAATATGAAGCATTTAGAACTACCATTCATGAGCAACAGCAACCTTTCAGCTAAAA
ATAAAACCCAGTCTCTTATTTGGCAACAGCGACCTCAGATTCTGGGTTGAGATCAGATAG
TAGCAGATAGTAATCTCTACAAATAATACAACGAACAACGCCGTCAAACGCCTACCTTGG
AAATAAACTCCGGAGCAAACTTGTAGAATTTTCGGCAGACCGGATCTGTCAAAAGAAGCT
ATCAGTTGTTGGAGCGGCAAAGCAGTCAT