The following data will be submitted to http://genome.ucsc.edu/cgi-bin/hgBlat

  

type: DNA
output: hyperlink
Other options
Genome: 
userSeq
>SS2U037834:361..843
GACGTGAGAGTATATCCACCTCCACCACAGTCTTTACCAGCAACAGATTCTTCCCGATTG
GGACCATTGCAGTATCCTGATTCCCCGTACTGCAATAAGTACAACAGTGAGACCATGTTC
CTGGGCATGCCAGAGGCTGGCCTGGACTTTGTGCCAACCAACCAGTTCCGTGTGCCTCCC
AACCCCCATCAGACGCAGACCAGCGCCAAGCAGACTGGACCCCTGTGGAAACGAGAAGGC
CCTGCTCACTCCGATGGCCCCCGGCTACCCTGGTCCTACCCAGTGCCCAGTTTGGGGGAT
GAAGACTTCAACATTCCACCCATCACACCTCCCACCATCCCAGAACACATGCTGCACCCC
CACCTACCAGAGTCGGAGTCTGGCTCCTACCACCCACTGGCCCCCTCTCACTCCCAGAGT
GGCCTGCACCCCTTCCACCTGCAGGGAATGGACATGATGGGTCAGGATGGAGGGCTGTTG
AGC