The following data will be submitted to http://genome.ucsc.edu/cgi-bin/hgBlat

  

type: DNA
output: hyperlink
Other options
Genome: 
userSeq
>OM2U025366:231..851
AACCCCACCGAGCAGACTAGCTCCAACAGACTGGCCCCTGTGAAACGAGAAGGCCTTGCT
CACTCCGATGGCCCCCGGCTACCCTGGTCCTACCCAGTGCACAGTCTGGGGTATGAAGAC
TTCAACAGTCCCCCCATCACGCCTCCCACCATCTCAGAACACATGCTGCACCCCCACTTA
CCAGAGTCGGAGTCTGGCTCCTACCACCCGCTGGCACCCTCTCACTCCCAGAGTGGCCTG
CACCCCTTCCACTTGCAGGGAATGGACATGATGGGTCAGGATGGAGGGCTGTTGAGCCAA
AATGGCGGCCTAATGTCCAGCACCCTGTCTGTGATGCAACAAATGGTCAATTCCGATTCC
CGGTACAGCAGCCATCAGCCAATGGAAGCGCTCAGACCCAGGAGCCAATCAGGCATGGGA
CATCAGAGTCAGCTGACCACCATCAACCAATCACAACTCAATGCCCAGTTGGGACTGAGC
GGGAACAACGTTACCCATAATTCCCCATCTCCCCCTGGGAGCAAGTCGGCCACACCCTCT
CCTTCTAGTCCGACATGAGAGCAGAATCATAAAGGCAGAGAAGCGACCGGCAGCGCTCGA
ATCCAACAGACCAAAAAAAAA